eagle-i Harvard UniversityHarvard University

stripe

eagle-i ID

http://harvard.eagle-i.net/i/0000012e-548d-8cac-55da-381e80000000

Resource Type

  1. Construct insert

Properties

  1. Source Organism
    Drosophila
  2. Resource Description
    FWD Oligo: CACCGAATTCCGAGTACAGTCCATCCACCA, RVS Oligo: CTTTTCCTTCTTGATGCGCT
  3. Resource Description
    Hairpin ID: TR02247P.1
  4. Accession Number
    FBgn0003499
 
RDFRDF
 
Provenance Metadata About This Resource Record

    Copyright © 2016 by the President and Fellows of Harvard College
    The eagle-i Consortium is supported by NIH Grant #5U24RR029825-02 / Copyright 2016