eagle-i Harvard UniversityHarvard University
See it in Search
This page is a preview of the following resource. Continue onto eagle-i search using the button on the right to see the full record.

Human ChAT Q-PCR primer set

eagle-i ID

http://harvard.eagle-i.net/i/0000012d-a572-9938-4882-b08d80000000

Resource Type

  1. Primer

Properties

  1. Resource Description
    PRODUCT SIZE 177bp PRODUCT POSITION (mRNA): NUCLEOTIDES 1106-1282 EXONS 2
  2. Additional Name
    Choline O-acetyltransferase Q-PCR primer set
  3. Additional Name
    Q-PCR Primer set (Forward and Reverse)
  4. Contact
    Vanderburg, Charles, Ph.D.
  5. Entrez Gene ID
    NC_000010
  6. Website(s)
    http://www.neurodiscovery.harvard.edu/images/stories/HND/for_research/atrc/atrc_downloads/reagent_details/ChAT_Human.pdf
  7. Related Technique
    Real-time PCR
  8. Entrez Gene Symbol
    ChAT
  9. Sequence
    FORWARD: TCATTAATTTCCGCCGTCTC
  10. Sequence
    REVERSE: AGTCCCGGTTGGTGGAGTC
  11. Location
    Harvard NeuroDiscovery Center - Advanced Tissue Resource Center (HMS)
 
RDFRDF
 
Provenance Metadata About This Resource Record

Copyright © 2016 by the President and Fellows of Harvard College
The eagle-i Consortium is supported by NIH Grant #5U24RR029825-02 / Copyright 2016