eagle-i Harvard UniversityHarvard University
See it in Search
This page is a preview of the following resource. Continue onto eagle-i search using the button on the right to see the full record.

Human α-Synuclein Q-PCR Primer set

eagle-i ID

http://harvard.eagle-i.net/i/0000012d-a50b-6a0d-4882-b08d80000000

Resource Type

  1. Primer

Properties

  1. Resource Description
    PRODUCT SIZE 234bp PRODUCT POSITION (mRNA): NUCLEOTIDES 188-421 EXONS 3-5
  2. Additional Name
    Synuclein alpha Q-PCR Primer set (Forward and Reverse)
  3. Contact
    Vanderburg, Charles, Ph.D.
  4. Entrez Gene ID
    NT_016354.17
  5. Website(s)
    http://www.neurodiscovery.harvard.edu/images/stories/HND/for_research/atrc/atrc_downloads/reagent_details/SNCA%20Human.pdf
  6. Related Technique
    Real-time PCR
  7. Entrez Gene Symbol
    SNCA
  8. Sequence
    FORWARD: AGTGACAAATGTTGGAGGAG Tm: 55°C
  9. Sequence
    REVERSE: GCTTCAGGTTCGTAGTCTTG Tm: 55°C
  10. Location
    Harvard NeuroDiscovery Center - Advanced Tissue Resource Center (HMS)
 
RDFRDF
 
Provenance Metadata About This Resource Record

Copyright © 2016 by the President and Fellows of Harvard College
The eagle-i Consortium is supported by NIH Grant #5U24RR029825-02 / Copyright 2016